The sequences have been pasted in for you. Hit the submit button to perform the alignment. The sequences are those of Example 1. If you need help in using this website, there is a Tutorial as well as specific help on this "Use it" page. There is also specific help on the results returned by this page.

Input Sequences

Paste plain mRNA/EST Sequence below (25,000 nucleotides maximum)
ATGCGATAGCGATAGCGATAGCGATAGCAGATGACGATAGCAGT
or select a FASTA file from your local disk below


Paste plain Genomic Sequence below (250,000 nucleotides maximum)
GATAGATAGCGATAGCAGATAGCAGATAGCAGATGACGATAGCAGATGACGATAGC
or select a FASTA file from your local disk below